negative control sirnas with scramble sequence  (Shanghai GenePharma)

Journal: Cardiovascular Research

Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

doi: 10.1093/cvr/cvaf037

Figure Lengend Snippet: TTN-AS1-276 regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

Techniques: RNA Sequencing, Derivative Assay, Transfection, Negative Control, Quantitative RT-PCR, Expressing, Control

Journal: Cardiovascular Research

Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

doi: 10.1093/cvr/cvaf037

Figure Lengend Snippet: TTN-AS1-276 facilitates interaction between RBM20 and TTN mRNA. ( A – C ) Human iPS-derived cardiomyocytes (iPS-CM) were subjected to combined RNA in situ hybridization (ISH) for TTN-AS1-276 (magenta) and TTN (orange) and immunofluorescence for RBM20 (green) following transfection with siRNA towards TTN-AS1-276 (si276-Ex1), RBM20 (siRBM20), or scrambled negative control siRNA (siScr). Nuclei were counterstained with DAPI. Co-localization of TTN and RBM20 foci was analysed with high content imaging. ( D ) Depiction of experimental design for the RBM20 RNA immunoprecipitation (RIP) experiment. iPS-CM was transfected with a plasmid expressing a RBM20-GFP fusion protein. RIP was performed on iPS-CM protein using a GFP antibody and qRT–PCR was used to analyse immunoprecipitated RNA. ( E ) Enrichment of TTN and TTN-AS1-276 in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group * P < 0.05, ** P < 0.01. ( F ) The number of TCTT motifs/60 bp across intron 49 of TTN . The positions of RIP-qPCR assays used in ( G ) are indicated with dashed lines. ( G ) qPCR of GFP-RBM20 RIP RNA from ( E ) using assays targeting regions in intron 49 without TCTT motifs (‘In49 5p’) and enriched with TCTT motifs (‘In49 TCTT’). Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group. Differences in the RIP signal between cells transfected within and between groups were assessed using ANOVA with Dunnett’s multiple comparisons test, * P < 0.05, ** P < 0.01.

Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

Techniques: Derivative Assay, RNA In Situ Hybridization, Immunofluorescence, Transfection, Negative Control, Imaging, RNA Immunoprecipitation, Plasmid Preparation, Expressing, Quantitative RT-PCR, Immunoprecipitation

Journal: Cardiovascular Research

Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

doi: 10.1093/cvr/cvaf037

Figure Lengend Snippet: TTN-AS1-276 facilitates splicing of additional RBM20 targets. ( A – C ) Difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1, blue) or RBM20 (siRBM20, red) with cells transfected with scrambled negative control siRNA (siScr) across all exons of the ( A ) CACNA1C , ( B ) LMO7 , and ( C ) CAMK2D genes in human iPS-derived cardiomyocytes (iPS-CM). The lines represent the mean of three technical replicates (individual RNA preparations). ( D – F ) Relative expression of alternative splice products of the ( D ) CACNA1C , ( E ) LMO7 , and ( F ) CAMK2D genes in iPS-CM transfected with siRBM20, si276-Ex1 or siScr and analysed with qRT–PCR ( CACNA1C and LMO7 ) and semi-quantitative RT–PCR ( CAMK2D ), respectively. Data are derived from three separate experiments with three technical replicates (individual RNA preparations) in each group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001. ( G ) Enrichment of CACNA1C , LMO7 , and CAMK2D in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments.

Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

Techniques: Transfection, Negative Control, Derivative Assay, Expressing, Quantitative RT-PCR, Control

Journal: Scientific Reports

Article Title: ERα status of invasive ductal breast carcinoma as a result of regulatory interactions between lysine deacetylases KAT6A and KAT6B

doi: 10.1038/s41598-024-78432-0

Figure Lengend Snippet: Downregulation of KAT6A/B mRNAs and protein expression by siRNA-induced knock-down in breast cancer cell lines MCF-7 and MDA-MB-231. Quantitative polymerase chain reaction was used to analyze KAT6A, KAT6B and ERα mRNA expression in MCF-7 cell line ( A ) and KAT6A and KAT6B in MDA-MB-231 cell line ( B ). Western blot analysis ( F ) measured the effects of siRNA-mediated knockdown of KAT6A, KAT6B and ER in MCF-7 ( C ) and KAT6A/B in MDA-MB-231 ( D ) cell lines. GAPDH was used as an internal control ( E ). Data represent the mean and standard deviation of three independent experiments. Comparisons between groups were done using Student’s t-test: * p < 0.1; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Source data are provided as a Supplementary S1.

Article Snippet: Ambion predesigned siRNAs, including GAPDH siRNA as a positive control and scrambled sequence siRNA as a negative control, were used in the experiments.

Techniques: Expressing, Knockdown, Real-time Polymerase Chain Reaction, Western Blot, Control, Standard Deviation

Journal: iScience

Article Title: Altering heparan sulfate suppresses cell abnormalities and neuron loss in Drosophila presenilin model of Alzheimer Disease

doi: 10.1016/j.isci.2024.110256

Figure Lengend Snippet: Knockdown of Ndst1 in primary mouse astrocytes lowers levels of intracellular liposomes (A) Micrographs showing levels of lipid droplets (LD), a marker for lentiviral transfection (green), and nuclear stain (DAPI, blue) in control, cells transfected with either a scramble sequence shRNA vector or one targeting Ndst1. Ndst1 shRNA produced reduced levels of LD number and volume (panels on the right), as well as decreases in Plin2 expression measured by qPCR. (B) The effect of Ndst1 shRNA was evaluated on astrocytes from animals expressing humanized variants of APOE3 and APOE4. LD volumes were significantly reduced by Ndst1 knockdown compared to scramble controls in astrocytes from either of these two genotypes [images show individual cells, nuclei (blue), and LD (red), and graphs provide quantitation of LD volumes. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001). Error bars represent SEM.

Article Snippet: Lentivirus Negative Scramble shRNA Target Sequence: GCACTACCAGAGCTAACTCAGATAGTACT , Origene , Cat#TR30021.

Techniques: Knockdown, Liposomes, Marker, Transfection, Staining, Control, Sequencing, shRNA, Plasmid Preparation, Produced, Expressing, Quantitation Assay

Journal: iScience

Article Title: Altering heparan sulfate suppresses cell abnormalities and neuron loss in Drosophila presenilin model of Alzheimer Disease

doi: 10.1016/j.isci.2024.110256

Figure Lengend Snippet:

Article Snippet: Lentivirus Negative Scramble shRNA Target Sequence: GCACTACCAGAGCTAACTCAGATAGTACT , Origene , Cat#TR30021.

Techniques: Virus, shRNA, Sequencing, Recombinant, Staining, Synthesized, Transfection, Software, RNA Sequencing

Journal: Bioactive Materials

Article Title: Lysosomal destabilization: A missing link between pathological calcification and osteoarthritis

doi: 10.1016/j.bioactmat.2023.12.001

Figure Lengend Snippet: Hydroxyapatite induced cytosolic CTSB contributed to NLRP3 inflammasome activation and caused chondrocyte pyroptosis. A) The Western blot result and quantitative analysis of Cathepsin B (CTSB) protein level of chondrocytes after transfected with siRNA targeting CTSB (si-CTSB). B) NLRP3, Caspase1 p20 and N-GSDMD protein levels of chondrocytes after the designated treatment, as determined by Western blot. C) Immunofluorescence staining of CTSB protein in chondrocytes of different groups. Scale bar: 10 μm. D) Fluorescence co-staining of propidium iodide (PI) and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. E) Quantitative analysis of the fluorescence intensity of CTSB protein in (C) (n = 3). F–H) Quantitative analysis of NLRP3, Caspase1 p20 and N-GSDMD protein levels in (B) (n = 3). I-J) Quantitative analysis of IL-1β and lactate dehydrogenase (LDH) levels in chondrocyte culture supernatants of different groups (n = 3). K) Quantitative analysis of the percentage of PI-positive chondrocytes in (D) (n = 3). L) Cytosolic CTSB protein level and total NLRP3, Caspase1 p20, N-GSDMD, collagen II and aggrecan protein levels of chondrocytes after the designated treatment, as determined by Western blot. M) Fluorescence co-staining of PI and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. N ) Schematic depicting the mechanism whereby hydroxyapatite (HAp) triggered chondrocyte pyroptosis. Statistical analyses were performed using one-way ANOVA with Holm-Šidák multiple comparison tests. NS, no significance; *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Article Snippet: As a control, cells were transfected with sequence scrambled siRNA negative control (si-NC, sc-37007, Santa Cruz).

Techniques: Activation Assay, Western Blot, Transfection, Immunofluorescence, Staining, Fluorescence, Comparison